control scramble sirna Search Results


90
Millennium Science millennium cat# d-001810-10-05
Millennium Cat# D 001810 10 05, supplied by Millennium Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/millennium cat# d-001810-10-05/product/Millennium Science
Average 90 stars, based on 1 article reviews
millennium cat# d-001810-10-05 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Xeragon Inc fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)
Fluorescence Labelled Control, Scrambled And Human P140cap Specific Sirnas (Aagctgtgtctgttgaggctg), supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)/product/Xeragon Inc
Average 90 stars, based on 1 article reviews
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Ribobio co sirna of arg2, ho-1, creb1 and their matched scramble control
Sirna Of Arg2, Ho 1, Creb1 And Their Matched Scramble Control, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna of arg2, ho-1, creb1 and their matched scramble control/product/Ribobio co
Average 90 stars, based on 1 article reviews
sirna of arg2, ho-1, creb1 and their matched scramble control - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Genechem scrambled control sirna
The effects of bemcentinib and siSHC1 on NCI-3122 cells and crizotinib-resistant PDX tumors (A) Cell viability assays of NCI-H3122 and NCI-H3122-CR23 cells treated with crizotinib (Criz) for 72 h. The data are presented as mean ± SD from three independent experiments. (B) Immunoblotting with P-Tyr-100 of NCI-H3122 and NCI-H3122-CR23 cells treated with 1 μmol/L crizotinib for 4 h. Tubulin was used as the loading control. (C) Sequencing analysis of EML4-ALK showing a kinase domain heterozygous mutation F1174C in NCI-H3122-CR23. TTC in exon 23 of the ALK kinase region is replaced by TGC. (D) Immunoblotting of AXL in NCI-H3122-CR23 cells treated with different concentrations of bemcentinib (Bemcen) and NCI-H3122 with Veh (vehicle) for 72 h. Cell lysates were probed with the indicated antibodies. Tubulin was used as the loading control. (E) The viability of NCI-H3122-CR23 measured by MTS assay after treatment of bemcentinib (Bemcen) in combination with crizotinib (Criz) for 72 h. Results are representative of three independent experiments. The data are presented as mean ± SD. ∗∗ p ≤ 0.01. ∗∗∗ p ≤ 0.001. (F) The inhibition effect by the combined treatment of crizotinib and bemcentinib in the crizotinib-resistant PDX mouse model. Tumor volume fold changes and TIR (tumor inhibition ratio) were indicated with drugs. TIR was calculated after the 25-day treatment. ∗ p < 0.05. ∗∗ p < 0.01. ∗∗∗ p ≤ 0.001. (G) Immunoblotting of AXL and ALK in crizotinib-resistant PDX tumors treated with drugs indicated under the same conditions as in <xref ref-type=Figure 5 F. Tissue lysates were probed with the indicated antibodies. Tubulin was used as the loading control. Veh, Vehicle; Criz, crizotinib; Criz and Bemcen, crizotinib and bemcentinib. (H) Immunoblotting of NCI-H3122 cells treated with 1 μmol/L crizotinib for 4 h. Cell lysates were probed with the indicated antibodies. Veh, vehicle; Criz, Crizotinib. (I) SHC1 mRNA levels in NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) for 72 h. Cells mRNA were amplificated with the primers presented in Table S1 . Cont siRNA, negative control virus vector; #1 and #2 were two different interfering sequences of SHC1 mRNA. (J) Immunoblotting of NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) #2 for 72 h; cell lysates were probed with the indicated antibodies. (K) Cell viability assay of NCI-H3122 cells. NCI-H3122 cells were transfected with SHC1 siRNAs (siSHC1) #2 for 72 h and then treated with the indicated concentration of crizotinib for 72 h. Control cells were transfected with scrambled siRNA. Results are representative of three independent experiments. The data are presented as mean ± SD. Cont siRNA, negative control virus vector; Criz, crizotinib. ∗∗ p < 0.01. ∗∗∗∗ p = 0.000. " width="250" height="auto" />
Scrambled Control Sirna, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled control sirna/product/Genechem
Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen sirna predesigned control (scrambled or scr), kdr sirna sequences
The effects of bemcentinib and siSHC1 on NCI-3122 cells and crizotinib-resistant PDX tumors (A) Cell viability assays of NCI-H3122 and NCI-H3122-CR23 cells treated with crizotinib (Criz) for 72 h. The data are presented as mean ± SD from three independent experiments. (B) Immunoblotting with P-Tyr-100 of NCI-H3122 and NCI-H3122-CR23 cells treated with 1 μmol/L crizotinib for 4 h. Tubulin was used as the loading control. (C) Sequencing analysis of EML4-ALK showing a kinase domain heterozygous mutation F1174C in NCI-H3122-CR23. TTC in exon 23 of the ALK kinase region is replaced by TGC. (D) Immunoblotting of AXL in NCI-H3122-CR23 cells treated with different concentrations of bemcentinib (Bemcen) and NCI-H3122 with Veh (vehicle) for 72 h. Cell lysates were probed with the indicated antibodies. Tubulin was used as the loading control. (E) The viability of NCI-H3122-CR23 measured by MTS assay after treatment of bemcentinib (Bemcen) in combination with crizotinib (Criz) for 72 h. Results are representative of three independent experiments. The data are presented as mean ± SD. ∗∗ p ≤ 0.01. ∗∗∗ p ≤ 0.001. (F) The inhibition effect by the combined treatment of crizotinib and bemcentinib in the crizotinib-resistant PDX mouse model. Tumor volume fold changes and TIR (tumor inhibition ratio) were indicated with drugs. TIR was calculated after the 25-day treatment. ∗ p < 0.05. ∗∗ p < 0.01. ∗∗∗ p ≤ 0.001. (G) Immunoblotting of AXL and ALK in crizotinib-resistant PDX tumors treated with drugs indicated under the same conditions as in <xref ref-type=Figure 5 F. Tissue lysates were probed with the indicated antibodies. Tubulin was used as the loading control. Veh, Vehicle; Criz, crizotinib; Criz and Bemcen, crizotinib and bemcentinib. (H) Immunoblotting of NCI-H3122 cells treated with 1 μmol/L crizotinib for 4 h. Cell lysates were probed with the indicated antibodies. Veh, vehicle; Criz, Crizotinib. (I) SHC1 mRNA levels in NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) for 72 h. Cells mRNA were amplificated with the primers presented in Table S1 . Cont siRNA, negative control virus vector; #1 and #2 were two different interfering sequences of SHC1 mRNA. (J) Immunoblotting of NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) #2 for 72 h; cell lysates were probed with the indicated antibodies. (K) Cell viability assay of NCI-H3122 cells. NCI-H3122 cells were transfected with SHC1 siRNAs (siSHC1) #2 for 72 h and then treated with the indicated concentration of crizotinib for 72 h. Control cells were transfected with scrambled siRNA. Results are representative of three independent experiments. The data are presented as mean ± SD. Cont siRNA, negative control virus vector; Criz, crizotinib. ∗∗ p < 0.01. ∗∗∗∗ p = 0.000. " width="250" height="auto" />
Sirna Predesigned Control (Scrambled Or Scr), Kdr Sirna Sequences, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna predesigned control (scrambled or scr), kdr sirna sequences/product/Qiagen
Average 90 stars, based on 1 article reviews
sirna predesigned control (scrambled or scr), kdr sirna sequences - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma scrambled control sirna
The effects of bemcentinib and siSHC1 on NCI-3122 cells and crizotinib-resistant PDX tumors (A) Cell viability assays of NCI-H3122 and NCI-H3122-CR23 cells treated with crizotinib (Criz) for 72 h. The data are presented as mean ± SD from three independent experiments. (B) Immunoblotting with P-Tyr-100 of NCI-H3122 and NCI-H3122-CR23 cells treated with 1 μmol/L crizotinib for 4 h. Tubulin was used as the loading control. (C) Sequencing analysis of EML4-ALK showing a kinase domain heterozygous mutation F1174C in NCI-H3122-CR23. TTC in exon 23 of the ALK kinase region is replaced by TGC. (D) Immunoblotting of AXL in NCI-H3122-CR23 cells treated with different concentrations of bemcentinib (Bemcen) and NCI-H3122 with Veh (vehicle) for 72 h. Cell lysates were probed with the indicated antibodies. Tubulin was used as the loading control. (E) The viability of NCI-H3122-CR23 measured by MTS assay after treatment of bemcentinib (Bemcen) in combination with crizotinib (Criz) for 72 h. Results are representative of three independent experiments. The data are presented as mean ± SD. ∗∗ p ≤ 0.01. ∗∗∗ p ≤ 0.001. (F) The inhibition effect by the combined treatment of crizotinib and bemcentinib in the crizotinib-resistant PDX mouse model. Tumor volume fold changes and TIR (tumor inhibition ratio) were indicated with drugs. TIR was calculated after the 25-day treatment. ∗ p < 0.05. ∗∗ p < 0.01. ∗∗∗ p ≤ 0.001. (G) Immunoblotting of AXL and ALK in crizotinib-resistant PDX tumors treated with drugs indicated under the same conditions as in <xref ref-type=Figure 5 F. Tissue lysates were probed with the indicated antibodies. Tubulin was used as the loading control. Veh, Vehicle; Criz, crizotinib; Criz and Bemcen, crizotinib and bemcentinib. (H) Immunoblotting of NCI-H3122 cells treated with 1 μmol/L crizotinib for 4 h. Cell lysates were probed with the indicated antibodies. Veh, vehicle; Criz, Crizotinib. (I) SHC1 mRNA levels in NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) for 72 h. Cells mRNA were amplificated with the primers presented in Table S1 . Cont siRNA, negative control virus vector; #1 and #2 were two different interfering sequences of SHC1 mRNA. (J) Immunoblotting of NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) #2 for 72 h; cell lysates were probed with the indicated antibodies. (K) Cell viability assay of NCI-H3122 cells. NCI-H3122 cells were transfected with SHC1 siRNAs (siSHC1) #2 for 72 h and then treated with the indicated concentration of crizotinib for 72 h. Control cells were transfected with scrambled siRNA. Results are representative of three independent experiments. The data are presented as mean ± SD. Cont siRNA, negative control virus vector; Criz, crizotinib. ∗∗ p < 0.01. ∗∗∗∗ p = 0.000. " width="250" height="auto" />
Scrambled Control Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled control sirna/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma 6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas
The effects of bemcentinib and siSHC1 on NCI-3122 cells and crizotinib-resistant PDX tumors (A) Cell viability assays of NCI-H3122 and NCI-H3122-CR23 cells treated with crizotinib (Criz) for 72 h. The data are presented as mean ± SD from three independent experiments. (B) Immunoblotting with P-Tyr-100 of NCI-H3122 and NCI-H3122-CR23 cells treated with 1 μmol/L crizotinib for 4 h. Tubulin was used as the loading control. (C) Sequencing analysis of EML4-ALK showing a kinase domain heterozygous mutation F1174C in NCI-H3122-CR23. TTC in exon 23 of the ALK kinase region is replaced by TGC. (D) Immunoblotting of AXL in NCI-H3122-CR23 cells treated with different concentrations of bemcentinib (Bemcen) and NCI-H3122 with Veh (vehicle) for 72 h. Cell lysates were probed with the indicated antibodies. Tubulin was used as the loading control. (E) The viability of NCI-H3122-CR23 measured by MTS assay after treatment of bemcentinib (Bemcen) in combination with crizotinib (Criz) for 72 h. Results are representative of three independent experiments. The data are presented as mean ± SD. ∗∗ p ≤ 0.01. ∗∗∗ p ≤ 0.001. (F) The inhibition effect by the combined treatment of crizotinib and bemcentinib in the crizotinib-resistant PDX mouse model. Tumor volume fold changes and TIR (tumor inhibition ratio) were indicated with drugs. TIR was calculated after the 25-day treatment. ∗ p < 0.05. ∗∗ p < 0.01. ∗∗∗ p ≤ 0.001. (G) Immunoblotting of AXL and ALK in crizotinib-resistant PDX tumors treated with drugs indicated under the same conditions as in <xref ref-type=Figure 5 F. Tissue lysates were probed with the indicated antibodies. Tubulin was used as the loading control. Veh, Vehicle; Criz, crizotinib; Criz and Bemcen, crizotinib and bemcentinib. (H) Immunoblotting of NCI-H3122 cells treated with 1 μmol/L crizotinib for 4 h. Cell lysates were probed with the indicated antibodies. Veh, vehicle; Criz, Crizotinib. (I) SHC1 mRNA levels in NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) for 72 h. Cells mRNA were amplificated with the primers presented in Table S1 . Cont siRNA, negative control virus vector; #1 and #2 were two different interfering sequences of SHC1 mRNA. (J) Immunoblotting of NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) #2 for 72 h; cell lysates were probed with the indicated antibodies. (K) Cell viability assay of NCI-H3122 cells. NCI-H3122 cells were transfected with SHC1 siRNAs (siSHC1) #2 for 72 h and then treated with the indicated concentration of crizotinib for 72 h. Control cells were transfected with scrambled siRNA. Results are representative of three independent experiments. The data are presented as mean ± SD. Cont siRNA, negative control virus vector; Criz, crizotinib. ∗∗ p < 0.01. ∗∗∗∗ p = 0.000. " width="250" height="auto" />
6 Carboxyfluorescein Tagged, Negative Control (Nc) Scrambled Sirnas, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen pgc1 α mixed or control scrambled sirna
Transcriptomic analysis of FSHD myogenesis reveals suppression of <t>PGC1</t> <t>α</t> and ERR α . ( A ) A multivariate regression model was fit to the time course RNA-seq data describing the control 54-6 and FSHD 54-12 myoblasts during myogenesis. Coefficient a i attains positive values if gene i is up-regulated in FSHD versus controls and negative values if down-regulated. Coefficient b i attains positive values if gene i is up-regulated during myogenic differentiation and negative values if down-regulated. Coefficient c i attains positive values if gene i is up-regulated during differentiation in FSHD and negative values if down-regulated. As an example, time course expression plots are shown for the genes with the highest coefficient values for coefficient a i (CDKN2A) , b i (MYOM2) and c i (DOC2B) , where thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( B ) Bar plot displays log 10 enrichment P -values for the top 5 enriched gene sets among the 500 genes with the most negative c i coefficient (i.e. those suppressed in FSHD myogenesis). We see clear enrichment for target genes of ERR α and genes involved in mitochondrial processes. ( C ) Expression of ESRRA (ERR α ) in FSHD 54-12 and matched control 54-6 myoblasts from RNA-seq analysis. Significant repression in FSHD myogenesis begins from day 1 of differentiation. Thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( D ) Expression of PPARGC1A (PGC1 α ) in FSHD 54-12 and matched control 54-6 myoblasts from RNA-seq analysis. Significant repression in FSHD myoblasts occurs at all time points analysed. Thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( E ) The 500 genes with the most negative c i coefficient (i.e. those suppressed in FSHD myogenesis) identified in the data set of the FSHD 54-12 and control 54-6 myoblasts were tested on RNA-seq data from FSHD 16Abic and control 16Ubic at time 0, confluent myoblasts (myob) and time 5040 min, mature myotubes (Myot). Box-plots demonstrate that the mean expression of these 500 genes with the most negative c i coefficient was also significantly lower in 16Abic FSHD myotubes versus 16Ubic control myotubes. The box represents the interquartile range (IQR), with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were tested using an unpaired two-tailed t -test. ( F ) Expression of PPARGC1A (PGC1 α ) is suppressed in RNA-seq from FSHD 16Abic, 12Abic, 54-2 and 54-A5 cell lines at both time 0, confluent myoblasts and time 5040 min, mature myotube stage, compared to control 16Ubic, 12Ubic, 54-A10 cell lines. The box represents the IQR, with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were z -normalised within FSHD-control groups and tested using an unpaired Wilcoxon test. ( G ) Expression of ESRRA (ERR α ) is suppressed only in RNA-seq from FSHD 16Abic, 12Abic, 54-2 and 54-A5 cell lines at the time 5040 min mature myotube stage, compared to control 16Ubic, 12Ubic and 54-A10 cell lines. The box represents the IQR, with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were z -normalised within FSHD-control groups and tested using an unpaired Wilcoxon test.
Pgc1 α Mixed Or Control Scrambled Sirna, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgc1 α mixed or control scrambled sirna/product/Qiagen
Average 90 stars, based on 1 article reviews
pgc1 α mixed or control scrambled sirna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen scramble control sirnas 1027281
miR-375 Is Downregulated <t>in</t> <t>FUS</t> Mutant MNs (A) Venn diagram showing the relations between differentially expressed miRNAs at different time points of MN maturation, as resulting from TaqMan array cards analysis in FUS WT and FUS P525L iPSC-derived MNs at day 12 and 12 + 7, and small RNA-seq at day 12 + 7 (p < 0.05). (B) Validation of selected miRNAs by real-time qRT-PCR in MNs at day 12 + 7. Expression levels in FUS P525L and FUS P525L #2 are shown as relative to their respective isogenic FUS WT controls, set to a value of 1. Histogram bars represent the average of at least four independent experiments and error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗∗ p < 0.001; n.s., p > 0.05). (C) Real-time qRT-PCR analysis of the indicated miRNAs in FUS WT undifferentiated iPSCs and MNs (day 12 of differentiation, unsorted). miR-302a and miR-367 are pluripotency miRNAs; miR-218 is an MN-enriched miRNA. For each miRNA, the sample with the highest expression has been used as the calibrator. Histogram bars represent the average of a technical replicate (n = 3) and error bars indicate the SD. (D) Real-time qRT-PCR analysis in differentiated FUS WT iPSCs (day 12) transfected with anti-FUS or control <t>siRNAs.</t> Histogram bars represent the expression relative to the siRNA control (average of three independent experiments). Error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗ p < 0.01; where not indicated p > 0.05). See also <xref ref-type=Figure S5 . " width="250" height="auto" />
Scramble Control Sirnas 1027281, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble control sirnas 1027281/product/Qiagen
Average 90 stars, based on 1 article reviews
scramble control sirnas 1027281 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Ribobio co scrambled control sirna
miR-375 Is Downregulated <t>in</t> <t>FUS</t> Mutant MNs (A) Venn diagram showing the relations between differentially expressed miRNAs at different time points of MN maturation, as resulting from TaqMan array cards analysis in FUS WT and FUS P525L iPSC-derived MNs at day 12 and 12 + 7, and small RNA-seq at day 12 + 7 (p < 0.05). (B) Validation of selected miRNAs by real-time qRT-PCR in MNs at day 12 + 7. Expression levels in FUS P525L and FUS P525L #2 are shown as relative to their respective isogenic FUS WT controls, set to a value of 1. Histogram bars represent the average of at least four independent experiments and error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗∗ p < 0.001; n.s., p > 0.05). (C) Real-time qRT-PCR analysis of the indicated miRNAs in FUS WT undifferentiated iPSCs and MNs (day 12 of differentiation, unsorted). miR-302a and miR-367 are pluripotency miRNAs; miR-218 is an MN-enriched miRNA. For each miRNA, the sample with the highest expression has been used as the calibrator. Histogram bars represent the average of a technical replicate (n = 3) and error bars indicate the SD. (D) Real-time qRT-PCR analysis in differentiated FUS WT iPSCs (day 12) transfected with anti-FUS or control <t>siRNAs.</t> Histogram bars represent the expression relative to the siRNA control (average of three independent experiments). Error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗ p < 0.01; where not indicated p > 0.05). See also <xref ref-type=Figure S5 . " width="250" height="auto" />
Scrambled Control Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled control sirna/product/Ribobio co
Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Fasmac Co Ltd scramble control sirna uucuccgaacgugucacgutt
miR-375 Is Downregulated <t>in</t> <t>FUS</t> Mutant MNs (A) Venn diagram showing the relations between differentially expressed miRNAs at different time points of MN maturation, as resulting from TaqMan array cards analysis in FUS WT and FUS P525L iPSC-derived MNs at day 12 and 12 + 7, and small RNA-seq at day 12 + 7 (p < 0.05). (B) Validation of selected miRNAs by real-time qRT-PCR in MNs at day 12 + 7. Expression levels in FUS P525L and FUS P525L #2 are shown as relative to their respective isogenic FUS WT controls, set to a value of 1. Histogram bars represent the average of at least four independent experiments and error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗∗ p < 0.001; n.s., p > 0.05). (C) Real-time qRT-PCR analysis of the indicated miRNAs in FUS WT undifferentiated iPSCs and MNs (day 12 of differentiation, unsorted). miR-302a and miR-367 are pluripotency miRNAs; miR-218 is an MN-enriched miRNA. For each miRNA, the sample with the highest expression has been used as the calibrator. Histogram bars represent the average of a technical replicate (n = 3) and error bars indicate the SD. (D) Real-time qRT-PCR analysis in differentiated FUS WT iPSCs (day 12) transfected with anti-FUS or control <t>siRNAs.</t> Histogram bars represent the expression relative to the siRNA control (average of three independent experiments). Error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗ p < 0.01; where not indicated p > 0.05). See also <xref ref-type=Figure S5 . " width="250" height="auto" />
Scramble Control Sirna Uucuccgaacgugucacgutt, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble control sirna uucuccgaacgugucacgutt/product/Fasmac Co Ltd
Average 90 stars, based on 1 article reviews
scramble control sirna uucuccgaacgugucacgutt - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma taqman her-2 rt-qpcr kits
miR-375 Is Downregulated <t>in</t> <t>FUS</t> Mutant MNs (A) Venn diagram showing the relations between differentially expressed miRNAs at different time points of MN maturation, as resulting from TaqMan array cards analysis in FUS WT and FUS P525L iPSC-derived MNs at day 12 and 12 + 7, and small RNA-seq at day 12 + 7 (p < 0.05). (B) Validation of selected miRNAs by real-time qRT-PCR in MNs at day 12 + 7. Expression levels in FUS P525L and FUS P525L #2 are shown as relative to their respective isogenic FUS WT controls, set to a value of 1. Histogram bars represent the average of at least four independent experiments and error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗∗ p < 0.001; n.s., p > 0.05). (C) Real-time qRT-PCR analysis of the indicated miRNAs in FUS WT undifferentiated iPSCs and MNs (day 12 of differentiation, unsorted). miR-302a and miR-367 are pluripotency miRNAs; miR-218 is an MN-enriched miRNA. For each miRNA, the sample with the highest expression has been used as the calibrator. Histogram bars represent the average of a technical replicate (n = 3) and error bars indicate the SD. (D) Real-time qRT-PCR analysis in differentiated FUS WT iPSCs (day 12) transfected with anti-FUS or control <t>siRNAs.</t> Histogram bars represent the expression relative to the siRNA control (average of three independent experiments). Error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗ p < 0.01; where not indicated p > 0.05). See also <xref ref-type=Figure S5 . " width="250" height="auto" />
Taqman Her 2 Rt Qpcr Kits, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taqman her-2 rt-qpcr kits/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
taqman her-2 rt-qpcr kits - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


The effects of bemcentinib and siSHC1 on NCI-3122 cells and crizotinib-resistant PDX tumors (A) Cell viability assays of NCI-H3122 and NCI-H3122-CR23 cells treated with crizotinib (Criz) for 72 h. The data are presented as mean ± SD from three independent experiments. (B) Immunoblotting with P-Tyr-100 of NCI-H3122 and NCI-H3122-CR23 cells treated with 1 μmol/L crizotinib for 4 h. Tubulin was used as the loading control. (C) Sequencing analysis of EML4-ALK showing a kinase domain heterozygous mutation F1174C in NCI-H3122-CR23. TTC in exon 23 of the ALK kinase region is replaced by TGC. (D) Immunoblotting of AXL in NCI-H3122-CR23 cells treated with different concentrations of bemcentinib (Bemcen) and NCI-H3122 with Veh (vehicle) for 72 h. Cell lysates were probed with the indicated antibodies. Tubulin was used as the loading control. (E) The viability of NCI-H3122-CR23 measured by MTS assay after treatment of bemcentinib (Bemcen) in combination with crizotinib (Criz) for 72 h. Results are representative of three independent experiments. The data are presented as mean ± SD. ∗∗ p ≤ 0.01. ∗∗∗ p ≤ 0.001. (F) The inhibition effect by the combined treatment of crizotinib and bemcentinib in the crizotinib-resistant PDX mouse model. Tumor volume fold changes and TIR (tumor inhibition ratio) were indicated with drugs. TIR was calculated after the 25-day treatment. ∗ p < 0.05. ∗∗ p < 0.01. ∗∗∗ p ≤ 0.001. (G) Immunoblotting of AXL and ALK in crizotinib-resistant PDX tumors treated with drugs indicated under the same conditions as in <xref ref-type=Figure 5 F. Tissue lysates were probed with the indicated antibodies. Tubulin was used as the loading control. Veh, Vehicle; Criz, crizotinib; Criz and Bemcen, crizotinib and bemcentinib. (H) Immunoblotting of NCI-H3122 cells treated with 1 μmol/L crizotinib for 4 h. Cell lysates were probed with the indicated antibodies. Veh, vehicle; Criz, Crizotinib. (I) SHC1 mRNA levels in NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) for 72 h. Cells mRNA were amplificated with the primers presented in Table S1 . Cont siRNA, negative control virus vector; #1 and #2 were two different interfering sequences of SHC1 mRNA. (J) Immunoblotting of NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) #2 for 72 h; cell lysates were probed with the indicated antibodies. (K) Cell viability assay of NCI-H3122 cells. NCI-H3122 cells were transfected with SHC1 siRNAs (siSHC1) #2 for 72 h and then treated with the indicated concentration of crizotinib for 72 h. Control cells were transfected with scrambled siRNA. Results are representative of three independent experiments. The data are presented as mean ± SD. Cont siRNA, negative control virus vector; Criz, crizotinib. ∗∗ p < 0.01. ∗∗∗∗ p = 0.000. " width="100%" height="100%">

Journal: iScience

Article Title: AXL and SHC1 confer crizotinib resistance in patient-derived xenograft model of ALK-driven lung cancer

doi: 10.1016/j.isci.2024.110846

Figure Lengend Snippet: The effects of bemcentinib and siSHC1 on NCI-3122 cells and crizotinib-resistant PDX tumors (A) Cell viability assays of NCI-H3122 and NCI-H3122-CR23 cells treated with crizotinib (Criz) for 72 h. The data are presented as mean ± SD from three independent experiments. (B) Immunoblotting with P-Tyr-100 of NCI-H3122 and NCI-H3122-CR23 cells treated with 1 μmol/L crizotinib for 4 h. Tubulin was used as the loading control. (C) Sequencing analysis of EML4-ALK showing a kinase domain heterozygous mutation F1174C in NCI-H3122-CR23. TTC in exon 23 of the ALK kinase region is replaced by TGC. (D) Immunoblotting of AXL in NCI-H3122-CR23 cells treated with different concentrations of bemcentinib (Bemcen) and NCI-H3122 with Veh (vehicle) for 72 h. Cell lysates were probed with the indicated antibodies. Tubulin was used as the loading control. (E) The viability of NCI-H3122-CR23 measured by MTS assay after treatment of bemcentinib (Bemcen) in combination with crizotinib (Criz) for 72 h. Results are representative of three independent experiments. The data are presented as mean ± SD. ∗∗ p ≤ 0.01. ∗∗∗ p ≤ 0.001. (F) The inhibition effect by the combined treatment of crizotinib and bemcentinib in the crizotinib-resistant PDX mouse model. Tumor volume fold changes and TIR (tumor inhibition ratio) were indicated with drugs. TIR was calculated after the 25-day treatment. ∗ p < 0.05. ∗∗ p < 0.01. ∗∗∗ p ≤ 0.001. (G) Immunoblotting of AXL and ALK in crizotinib-resistant PDX tumors treated with drugs indicated under the same conditions as in Figure 5 F. Tissue lysates were probed with the indicated antibodies. Tubulin was used as the loading control. Veh, Vehicle; Criz, crizotinib; Criz and Bemcen, crizotinib and bemcentinib. (H) Immunoblotting of NCI-H3122 cells treated with 1 μmol/L crizotinib for 4 h. Cell lysates were probed with the indicated antibodies. Veh, vehicle; Criz, Crizotinib. (I) SHC1 mRNA levels in NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) for 72 h. Cells mRNA were amplificated with the primers presented in Table S1 . Cont siRNA, negative control virus vector; #1 and #2 were two different interfering sequences of SHC1 mRNA. (J) Immunoblotting of NCI-H3122 cells transfected with SHC1 siRNAs (siSHC1) #2 for 72 h; cell lysates were probed with the indicated antibodies. (K) Cell viability assay of NCI-H3122 cells. NCI-H3122 cells were transfected with SHC1 siRNAs (siSHC1) #2 for 72 h and then treated with the indicated concentration of crizotinib for 72 h. Control cells were transfected with scrambled siRNA. Results are representative of three independent experiments. The data are presented as mean ± SD. Cont siRNA, negative control virus vector; Criz, crizotinib. ∗∗ p < 0.01. ∗∗∗∗ p = 0.000.

Article Snippet: Control cells were transfected with a scrambled control siRNA (control sequence TTCTCCGAACGTGTCACGT) from Genechem.

Techniques: Western Blot, Control, Sequencing, Mutagenesis, MTS Assay, Inhibition, Transfection, Negative Control, Virus, Plasmid Preparation, Viability Assay, Concentration Assay

Transcriptomic analysis of FSHD myogenesis reveals suppression of PGC1 α and ERR α . ( A ) A multivariate regression model was fit to the time course RNA-seq data describing the control 54-6 and FSHD 54-12 myoblasts during myogenesis. Coefficient a i attains positive values if gene i is up-regulated in FSHD versus controls and negative values if down-regulated. Coefficient b i attains positive values if gene i is up-regulated during myogenic differentiation and negative values if down-regulated. Coefficient c i attains positive values if gene i is up-regulated during differentiation in FSHD and negative values if down-regulated. As an example, time course expression plots are shown for the genes with the highest coefficient values for coefficient a i (CDKN2A) , b i (MYOM2) and c i (DOC2B) , where thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( B ) Bar plot displays log 10 enrichment P -values for the top 5 enriched gene sets among the 500 genes with the most negative c i coefficient (i.e. those suppressed in FSHD myogenesis). We see clear enrichment for target genes of ERR α and genes involved in mitochondrial processes. ( C ) Expression of ESRRA (ERR α ) in FSHD 54-12 and matched control 54-6 myoblasts from RNA-seq analysis. Significant repression in FSHD myogenesis begins from day 1 of differentiation. Thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( D ) Expression of PPARGC1A (PGC1 α ) in FSHD 54-12 and matched control 54-6 myoblasts from RNA-seq analysis. Significant repression in FSHD myoblasts occurs at all time points analysed. Thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( E ) The 500 genes with the most negative c i coefficient (i.e. those suppressed in FSHD myogenesis) identified in the data set of the FSHD 54-12 and control 54-6 myoblasts were tested on RNA-seq data from FSHD 16Abic and control 16Ubic at time 0, confluent myoblasts (myob) and time 5040 min, mature myotubes (Myot). Box-plots demonstrate that the mean expression of these 500 genes with the most negative c i coefficient was also significantly lower in 16Abic FSHD myotubes versus 16Ubic control myotubes. The box represents the interquartile range (IQR), with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were tested using an unpaired two-tailed t -test. ( F ) Expression of PPARGC1A (PGC1 α ) is suppressed in RNA-seq from FSHD 16Abic, 12Abic, 54-2 and 54-A5 cell lines at both time 0, confluent myoblasts and time 5040 min, mature myotube stage, compared to control 16Ubic, 12Ubic, 54-A10 cell lines. The box represents the IQR, with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were z -normalised within FSHD-control groups and tested using an unpaired Wilcoxon test. ( G ) Expression of ESRRA (ERR α ) is suppressed only in RNA-seq from FSHD 16Abic, 12Abic, 54-2 and 54-A5 cell lines at the time 5040 min mature myotube stage, compared to control 16Ubic, 12Ubic and 54-A10 cell lines. The box represents the IQR, with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were z -normalised within FSHD-control groups and tested using an unpaired Wilcoxon test.

Journal: Human Molecular Genetics

Article Title: Dynamic transcriptomic analysis reveals suppression of PGC1 α /ERR α drives perturbed myogenesis in facioscapulohumeral muscular dystrophy

doi: 10.1093/hmg/ddy405

Figure Lengend Snippet: Transcriptomic analysis of FSHD myogenesis reveals suppression of PGC1 α and ERR α . ( A ) A multivariate regression model was fit to the time course RNA-seq data describing the control 54-6 and FSHD 54-12 myoblasts during myogenesis. Coefficient a i attains positive values if gene i is up-regulated in FSHD versus controls and negative values if down-regulated. Coefficient b i attains positive values if gene i is up-regulated during myogenic differentiation and negative values if down-regulated. Coefficient c i attains positive values if gene i is up-regulated during differentiation in FSHD and negative values if down-regulated. As an example, time course expression plots are shown for the genes with the highest coefficient values for coefficient a i (CDKN2A) , b i (MYOM2) and c i (DOC2B) , where thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( B ) Bar plot displays log 10 enrichment P -values for the top 5 enriched gene sets among the 500 genes with the most negative c i coefficient (i.e. those suppressed in FSHD myogenesis). We see clear enrichment for target genes of ERR α and genes involved in mitochondrial processes. ( C ) Expression of ESRRA (ERR α ) in FSHD 54-12 and matched control 54-6 myoblasts from RNA-seq analysis. Significant repression in FSHD myogenesis begins from day 1 of differentiation. Thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( D ) Expression of PPARGC1A (PGC1 α ) in FSHD 54-12 and matched control 54-6 myoblasts from RNA-seq analysis. Significant repression in FSHD myoblasts occurs at all time points analysed. Thick lines represent mean expression across triplicates and thin lines denote maximum and minimum expression values observed across triplicates. ( E ) The 500 genes with the most negative c i coefficient (i.e. those suppressed in FSHD myogenesis) identified in the data set of the FSHD 54-12 and control 54-6 myoblasts were tested on RNA-seq data from FSHD 16Abic and control 16Ubic at time 0, confluent myoblasts (myob) and time 5040 min, mature myotubes (Myot). Box-plots demonstrate that the mean expression of these 500 genes with the most negative c i coefficient was also significantly lower in 16Abic FSHD myotubes versus 16Ubic control myotubes. The box represents the interquartile range (IQR), with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were tested using an unpaired two-tailed t -test. ( F ) Expression of PPARGC1A (PGC1 α ) is suppressed in RNA-seq from FSHD 16Abic, 12Abic, 54-2 and 54-A5 cell lines at both time 0, confluent myoblasts and time 5040 min, mature myotube stage, compared to control 16Ubic, 12Ubic, 54-A10 cell lines. The box represents the IQR, with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were z -normalised within FSHD-control groups and tested using an unpaired Wilcoxon test. ( G ) Expression of ESRRA (ERR α ) is suppressed only in RNA-seq from FSHD 16Abic, 12Abic, 54-2 and 54-A5 cell lines at the time 5040 min mature myotube stage, compared to control 16Ubic, 12Ubic and 54-A10 cell lines. The box represents the IQR, with the median indicated by a line. Whiskers denote min [1.5 * IQR, max (observed value)]; values were z -normalised within FSHD-control groups and tested using an unpaired Wilcoxon test.

Article Snippet: PGC1 α mixed or control scrambled siRNA (Qiagen, Manchester, UK, catalogue number 1027416).

Techniques: RNA Sequencing Assay, Expressing, Two Tailed Test

siRNA-mediated knock-down of PGC1 α is sufficient to cause the hypotrophic FSHD myotube phenotype, which can be rescued by the ERR α agonist biochanin A. ( A ) RT-qPCR demonstrates that four combined siRNAs against PGC1 α successfully suppresses PGC1 α ( PPARGC1A ) in control 54-6 myoblasts. Data expressed as mean ± SEM where an asterisk denotes significant difference ( P < 0.05) using an unpaired two-tailed t -test. ( B ) Control 54-6 myoblasts were transfected with a mixture of four siRNAs against PGC1 α or a scrambled siRNA control and induced to differentiate for 3 days. Control 54-6 myoblasts were also transfected with combined siRNAs against PGC1 α or a scrambled siRNA control but also exposed to 10 μm biochanin A during 3 days of differentiation. Myotubes were then immunolabelled for MyHC and all nuclei counterstained with DAPI (Magnification: ×100). ( C ) PGC1 α knock-down significantly reduced MyHC+ve area. However, this PGC1 α knock-down mediated reduction in MyHC+ve area could be rescued to control levels by administration of 10 μm biochanin A to the differentiation medium. Data expressed as mean ± SEM ( n = 3 wells per line) where an asterisk denotes significant difference between the MyHC+ve area in 54-6 control siRNA/untreated versus treated conditions ( P < 0.05) using an unpaired two-tailed t -test.

Journal: Human Molecular Genetics

Article Title: Dynamic transcriptomic analysis reveals suppression of PGC1 α /ERR α drives perturbed myogenesis in facioscapulohumeral muscular dystrophy

doi: 10.1093/hmg/ddy405

Figure Lengend Snippet: siRNA-mediated knock-down of PGC1 α is sufficient to cause the hypotrophic FSHD myotube phenotype, which can be rescued by the ERR α agonist biochanin A. ( A ) RT-qPCR demonstrates that four combined siRNAs against PGC1 α successfully suppresses PGC1 α ( PPARGC1A ) in control 54-6 myoblasts. Data expressed as mean ± SEM where an asterisk denotes significant difference ( P < 0.05) using an unpaired two-tailed t -test. ( B ) Control 54-6 myoblasts were transfected with a mixture of four siRNAs against PGC1 α or a scrambled siRNA control and induced to differentiate for 3 days. Control 54-6 myoblasts were also transfected with combined siRNAs against PGC1 α or a scrambled siRNA control but also exposed to 10 μm biochanin A during 3 days of differentiation. Myotubes were then immunolabelled for MyHC and all nuclei counterstained with DAPI (Magnification: ×100). ( C ) PGC1 α knock-down significantly reduced MyHC+ve area. However, this PGC1 α knock-down mediated reduction in MyHC+ve area could be rescued to control levels by administration of 10 μm biochanin A to the differentiation medium. Data expressed as mean ± SEM ( n = 3 wells per line) where an asterisk denotes significant difference between the MyHC+ve area in 54-6 control siRNA/untreated versus treated conditions ( P < 0.05) using an unpaired two-tailed t -test.

Article Snippet: PGC1 α mixed or control scrambled siRNA (Qiagen, Manchester, UK, catalogue number 1027416).

Techniques: Quantitative RT-PCR, Two Tailed Test, Transfection

Suppression of PGC1 α / ERR α expression in FSHD and rescue by ERR α agonists. Schematic summarising that PGC1 α /ERR α suppression in FSHD drives an FSHD hypotrophic phenotype that can be rescued by ERR α agonists biochanin A, daidzein or genistein. Suppression of the ERR α /PGC1 α pathway in FSHD patients could also contribute to know features of FSHD pathology including oxidative stress sensitivity, aberrant vasculature and inflammation.

Journal: Human Molecular Genetics

Article Title: Dynamic transcriptomic analysis reveals suppression of PGC1 α /ERR α drives perturbed myogenesis in facioscapulohumeral muscular dystrophy

doi: 10.1093/hmg/ddy405

Figure Lengend Snippet: Suppression of PGC1 α / ERR α expression in FSHD and rescue by ERR α agonists. Schematic summarising that PGC1 α /ERR α suppression in FSHD drives an FSHD hypotrophic phenotype that can be rescued by ERR α agonists biochanin A, daidzein or genistein. Suppression of the ERR α /PGC1 α pathway in FSHD patients could also contribute to know features of FSHD pathology including oxidative stress sensitivity, aberrant vasculature and inflammation.

Article Snippet: PGC1 α mixed or control scrambled siRNA (Qiagen, Manchester, UK, catalogue number 1027416).

Techniques: Expressing

miR-375 Is Downregulated in FUS Mutant MNs (A) Venn diagram showing the relations between differentially expressed miRNAs at different time points of MN maturation, as resulting from TaqMan array cards analysis in FUS WT and FUS P525L iPSC-derived MNs at day 12 and 12 + 7, and small RNA-seq at day 12 + 7 (p < 0.05). (B) Validation of selected miRNAs by real-time qRT-PCR in MNs at day 12 + 7. Expression levels in FUS P525L and FUS P525L #2 are shown as relative to their respective isogenic FUS WT controls, set to a value of 1. Histogram bars represent the average of at least four independent experiments and error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗∗ p < 0.001; n.s., p > 0.05). (C) Real-time qRT-PCR analysis of the indicated miRNAs in FUS WT undifferentiated iPSCs and MNs (day 12 of differentiation, unsorted). miR-302a and miR-367 are pluripotency miRNAs; miR-218 is an MN-enriched miRNA. For each miRNA, the sample with the highest expression has been used as the calibrator. Histogram bars represent the average of a technical replicate (n = 3) and error bars indicate the SD. (D) Real-time qRT-PCR analysis in differentiated FUS WT iPSCs (day 12) transfected with anti-FUS or control siRNAs. Histogram bars represent the expression relative to the siRNA control (average of three independent experiments). Error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗ p < 0.01; where not indicated p > 0.05). See also <xref ref-type=Figure S5 . " width="100%" height="100%">

Journal: Stem Cell Reports

Article Title: FUS Mutant Human Motoneurons Display Altered Transcriptome and microRNA Pathways with Implications for ALS Pathogenesis

doi: 10.1016/j.stemcr.2017.09.004

Figure Lengend Snippet: miR-375 Is Downregulated in FUS Mutant MNs (A) Venn diagram showing the relations between differentially expressed miRNAs at different time points of MN maturation, as resulting from TaqMan array cards analysis in FUS WT and FUS P525L iPSC-derived MNs at day 12 and 12 + 7, and small RNA-seq at day 12 + 7 (p < 0.05). (B) Validation of selected miRNAs by real-time qRT-PCR in MNs at day 12 + 7. Expression levels in FUS P525L and FUS P525L #2 are shown as relative to their respective isogenic FUS WT controls, set to a value of 1. Histogram bars represent the average of at least four independent experiments and error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗∗ p < 0.001; n.s., p > 0.05). (C) Real-time qRT-PCR analysis of the indicated miRNAs in FUS WT undifferentiated iPSCs and MNs (day 12 of differentiation, unsorted). miR-302a and miR-367 are pluripotency miRNAs; miR-218 is an MN-enriched miRNA. For each miRNA, the sample with the highest expression has been used as the calibrator. Histogram bars represent the average of a technical replicate (n = 3) and error bars indicate the SD. (D) Real-time qRT-PCR analysis in differentiated FUS WT iPSCs (day 12) transfected with anti-FUS or control siRNAs. Histogram bars represent the expression relative to the siRNA control (average of three independent experiments). Error bars indicate the SD (Student's t test; paired; two tails; ∗ p < 0.05; ∗∗ p < 0.01; where not indicated p > 0.05). See also Figure S5 .

Article Snippet: Differentiating FUS WT iPSCs were transfected at 8 and 10 days with 40 nM anti-FUS siRNAs (SI00070518, QIAGEN) or scramble control siRNAs (1027281, QIAGEN).

Techniques: Mutagenesis, Derivative Assay, RNA Sequencing, Biomarker Discovery, Quantitative RT-PCR, Expressing, Transfection, Control